Archivos Latinoamericanos de Producción Animal. 2020. 28 (1­2)  
Seroconversión al VDVB en vacas coinfectadas con VLBE y HVB­1: fundamento de  
1
la calostrogénesis y efecto de la infección persistente causada por el VDVB  
Derling Pichardo­Matamoros2  
*Jorge Alberto Elizondo­Salazar3  
Carlos Jiménez­Sánchez4  
Facultad de Ciencias Agroalimentarias, Universidad de Costa Rica. San José, Costa Rica.  
Seroconversion to BVDV in cows coinfected with BLV and BHV­1: basis of colostrogenesis and effect  
of persistent infection caused by BVDV  
Abstract. Bovine viral diarrhea virus (BVDV), bovine leukosis virus (BLV), and bovine herpesvirus­1 (BHV­1) are  
very important pathogens in specialized dairies due to the negative impact they cause. Vaccination with BVDV is  
elementary to reduce its incidence and increase the concentration of antibodies in colostrum during colostrogenesis.  
This study evaluated whether the change in the vaccination program using live attenuated virus at one or two doses  
modified the serological status against BVDV in cows co­infected with VLBE and HVB­1. A vaccination trial against  
BVDV using the EXPRESS® FP 10­HS vaccine was conducted from November 8 to December 20, 2018. The study  
included 20 Holstein cows, of which 17 were seronegative for BVDV at baseline values of the study (0 days) and  
coinfected with VLBE and HVB­1. Changing the health status of BVDV seronegative to seropositive cows by enzyme­  
linked immunosorbent assay (ELISA) indicated seroconversion. The seroconversion monitoring of each cow was  
established at 21 and 42 days post­vaccination by ELISA. The seroconversion obtained was 93.75% (15/16),  
therefore, the vaccination program against BVDV was very efficient to achieve seroconversion independently of the  
dose, except in one animal with persistent infection for BVDV. Also, the presence of VLBE and HVB­1 did not inhibit  
antibody production. The information obtained suggests that mobilization of antibodies against BVDV into  
colostrum would occur without difficulty in co­infected animals that do not experience persistent infection with  
BVDV.  
Key words: bovine, immunity, vaccination, immunosuppression, colostrum.  
Resumen. Los virus de la diarrea viral bovina (VDVB), virus de la leucosis bovina enzoótica (VLBE) y herpesvirus  
bovino 1 (HVB­1) son patógenos muy importantes en lecherías especializadas debido al impacto negativo que  
ocasionan. La vacunación con el VDVB es elemental para reducir su incidencia e incrementar la concentración de  
anticuerpos en el calostro durante la calostrogénesis. Este estudio evaluó si el cambio en el programa de vacunación  
empleando virus vivo atenuado a una o dos dosis modificaba el estatus serológico contra el VDVB en vacas  
coinfectadas con VLBE y HVB­1. Se realizó un ensayo de vacunación contra el VDVB empleando la vacuna  
EXPRESS® FP 10­HS desde el 8 de noviembre al 20 de diciembre del 2018. El estudio incluyó 20 vacas de raza  
Holstein, de las cuales 17 fueron seronegativas para el VDVB al inicio del estudio (0 días) y coinfectadas con VLBE y  
HVB­1. El cambio del estatus sanitario de las vacas seronegativas al VDVB a seropositivas mediante la prueba de  
inmunoabsorción ligada a enzimas (ELISA) indicó seroconversión. El seguimiento de la seroconversión de cada  
vaca fue establecido a los 21 y 42 días post­vacunación mediante ELISA. La seroconversión obtenida fue de 93.75 %  
(
15/16), por lo que, el programa de vacunación contra VDVB fue muy eficiente para lograr seroconversión de forma  
independiente de la dosis, excepto en un animal con infección persistente para el VDVB. Asimismo, la presencia del  
Recibido: 2020­07­05. Aceptado: 2020­09­30.  
1Este trabajo formó parte del proyecto de investigación inscrito en la Vicerrectoría de Investigación, No. 737­B4­222. Universidad de Costa Rica,  
San José, Costa Rica.  
2Programa de Posgrado en Ciencias Agrícolas y Recursos Naturales, Facultad de Ciencias Agroalimentarias (FCA), Universidad de Costa Rica.  
3*  
Autor para la correspondencia: e­mail: jorge.elizondosalazar@ucr.ac.cr. Universidad de Costa Rica. Facultad de Ciencias Agroalimentarias.  
Estación Experimental Alfredo Volio Mata.  
4Universidad Nacional de Costa Rica. Escuela de Medicina Veterinaria. Programa de Investigación en Enfermedades Tropicales y Unidad de  
Diagnóstico e Investigación en Virología Veterinaria.  
3
9
40  
Seroconversión al VDVB en vacas coinfectadas con VLBE y HVB­1  
VLBE y HVB­1 no inhibió la producción de anticuerpos. La información obtenida sugiere que la movilización de  
anticuerpos contra el VDVB hacia el calostro ocurriría sin dificultad en animales coinfectados que no experimentan  
infección persistente con el VDVB.  
Palabras Claves: bovinos, inmunidad, vacunación, inmunosupresión, calostro.  
Introducción  
Los problemas de salud en el hato impactan de  
forma negativa la eficiencia productiva y reproductiva  
del rebaño, en especial, los ocasionados por  
enfermedades infecciosas, las cuales limitan  
significativamente la sostenibilidad de las fincas (Glass  
et al., 2012, Gutiérrez et al., 2017, Barrett et al., 2018).  
En tal sentido, las infecciones ocasionadas por el virus  
de la diarrea viral bovina (VDVB) (Reichel et al., 2018,  
Wathes et al., 2019), virus de la leucosis bovina  
enzoótica (VLBE) (Juliarena et al., 2017) y herpesvirus  
bovino 1 (HVB­1) (Dunn et al., 2018, Wathes et al.,  
pérdidas productivas (Romero et al., 2012, 2015). Por  
su parte, las enfermedades generadas por HVB­1 y  
VDVB son endémicas (Raizman et al., 2011).  
En regiones endémicas al VDVB, el suministro de  
calostro con anticuerpos específicos en terneros es  
esencial para reducir la incidencia de diarrea neonatal  
y neumonía enzoótica en los primeros tres meses de  
vida. Normalmente, el consumo de calostro con  
anticuerpos contra el VDVB favorece la supervivencia  
de los terneros debido a la neutralización del virus por  
los anticuerpos transferidos de forma pasiva mientras  
su sistema inmune madura (Chase et al., 2008,  
Pardon et al., 2012, Chamorro et al., 2014, Cho y Yoon  
2014).  
2
019) son de gran relevancia en ganado lechero.  
La infección con el VDVB, un Pestivirus dentro de la  
familia Flaviviridae, ocasiona pérdidas nivel  
mundial que varían de 33 a 687 dólares por animal  
infectado debido problemas productivos  
reproductivos (Richter et al., 2017, Reichel et al.,  
018). Por lo general, la infección se presenta de modo  
a
a
y
El calostro bovino es una mezcla de secreción láctea  
y
componentes del suero sanguíneo, rico en  
2
anticuerpos y proteínas séricas, las cuales se depositan  
en la glándula mamaria comúnmente 21 días antes del  
parto (Castro et al., 2011, Woolums 2014, De Paula et  
al., 2019). Por tanto, la vacunación de las madres  
contra el VDVB ayuda a disminuir la ocurrencia de  
nuevas infecciones (Givens y Newcomer 2017, Reichel  
et al., 2018). La nutrición también influye de forma  
significativa sobre el desarrollo de la respuesta inmune  
a la vacunación y calidad del calostro materno, por lo  
que, durante la síntesis del calostro el sistema inmune  
debe estar saludable para promover el éxito de la  
transferencia pasiva de inmunidad específica de tipo  
humoral contra los virus (Castro et al., 2011, Morrill  
2011, Maunsell 2014, Woolums 2014).  
inaparente o cursa con fiebre, inmunosupresión,  
diarrea o alteraciones respiratorias (Cho y Yoon 2014,  
Givens y Newcomer 2017, Wathes et al., 2019).  
El VLBE, un Deltaretrovirus dentro de la familia  
Retroviridae, causa una enfermedad llamada leucosis  
bovina enzoótica que cursa de forma crónica con  
disfunción del sistema inmune consecuente  
deterioro de la calidad del calostro (Frie y Coussens  
015, Suzuki et al., 2015, Blagitz et al., 2017, Iwan et  
y
2
al., 2017). Así mismo, se ha sugerido que una alta  
prevalencia del VLBE favorece la incidencia de HVB­1  
y del VDVB (Bilge­Dagalp et al., 2008, Nikbakht et al.,  
2
015).  
No obstante, la obtención de calostro con  
anticuerpos específicos contra el VDVB a partir de  
vacas con leucosis bovina enzoótica y coinfectadas con  
HVB­1 no está completamente dilucidado (Farias et  
al., 2016, Frie et al., 2016, 2017; Jaworski et al., 2018).  
Además, los programas de vacunación muchas veces  
no son muy eficientes debido al uso de vacunas  
inactivadas con bajo potencial antigénico o empleo de  
vacunas atenuadas con alto riesgo para provocar  
abortos o nacimiento de terneros persistentemente  
infectados (PI) (Givens y Newcomer 2017, Kato et al.,  
2015, Walz et al., 2017). A la fecha, no hay información  
sobre el efecto inmunosupresor causado por el VLBE y  
HVB­1 en conjunto sobre el desarrollo natural de la  
respuesta inmune humoral específica contra el VDVB,  
Por su parte, HVB­1 es un Varicellovirus dentro de la  
familia Herpesviridae, causa comúnmente una  
enfermedad  
infecciosa  
inmunosupresión,  
contagiosa  
bovina que  
alteraciones  
llamada  
también  
respiratorias  
rinotraqueitis  
provoca  
y
reproductivas (Dunn et al., 2018, Jones 2019). En  
consecuencia, la asociación de HVB­1 con el VLBE  
podría aumentar el impacto negativo sobre el sistema  
inmune.  
En Costa Rica, se confirmó la presencia del VLBE en  
995 (Jiménez et al., 1995), está presente en el 97.4 %  
de los hatos de ganado lechero especializado con  
incidencias por finca mayores al 40 % y causa grandes  
1
ISSN 1022­1301. Archivos Latinoamericanos de Producción Animal. 2020. 28 (1­2): 40­51  
4
1
Pichardo­Matamoros et al.  
seroconviertan contra el VDVB cuando son vacunados.  
Por tanto, el objetivo de este estudio fue evaluar en  
vacas coinfectadas con VLBE y HVB­1 si el programa  
de vacunación contra el VDVB basado en una o dos  
dosis de virus vivo modificado estimulaba la  
seroconversión.  
Materiales y Métodos  
Finca y animales  
El diseño del estudio consistió en un ensayo de  
campo de evidencia serológica en respuesta natural a la  
vacunación contra el VDVB. El estudio se llevó a cabo  
desde el 8 de noviembre al 20 de diciembre del 2018.  
Las 16 vacas seronegativas al VDVB y positivas para  
leucosis bovina enzoótica y HVB­1 al inicio del estudio  
fueron vacunadas. De estas, 11 recibieron dos  
aplicaciones y cinco vacas recibieron una aplicación de  
la vacuna EXPRESS® FP 10­HS (Boehringer  
Ingelheim Vetmedica, Germany) como estímulo  
antigénico para generar anticuerpos contra el VDVB.  
La vacuna contenía virus vivos modificados de HVB­1,  
VDVB tipo 1 (cepa Singer citopática) y tipo 2 (cepa 296  
Se seleccionó una finca seropositiva para la presencia  
del VLBE y sin antecedentes de vacunación contra el  
VDVB en los últimos tres años, localizada en San  
Carlos, Alajuela. Se obtuvo el consentimiento firmado  
del propietario antes de muestrear y vacunar a las  
vacas. Se eligieron 82 vacas en producción (57 Holstein  
y 25 Jersey), multíparas (2 a 8 lactancias) y desde 67 a  
2
70 días de lactación para determinar la presencia del  
VLBE, VDVB  
y
HVB­1 mediante pruebas de  
ligada enzimas (ELISA).  
inmunoabsorción  
a
Finalmente, se escogieron 20 vacas de raza Hosltein  
coinfectadas con VLBE y HVB­1 para diseñar el  
experimento.  
citopática), virus parainfluenza tipo virus  
respiratorio sincitial bovino, así como, bacterinas de  
Histophilus somni, Leptospira canicola, L.  
3
y
Toma y procesamiento de las muestras de  
sangre  
grippotyphosa, L. hardjo, L. icterohaemorrhagiae y L.  
Pomona. La vacuna fue aplicada con base en el  
protocolo estándar de vacunación (dos aplicaciones de  
la vacuna con intervalo de 21 días entre cada dosis)  
según instrucciones del fabricante y considerando lo  
publicado en la literatura (Kato et al., 2015, Frie et al.,  
Muestras de sangre fueron extraídas al inicio del  
estudio, antes y después del programa de vacunación  
durante el estudio experimental. Se recolectaron siete  
mL de sangre usando tubos de ensayo sin  
anticoagulante por punción de la vena coccígea  
empleando el sistema vacutainer®. El suero fue  
separado de la sangre a 4500 r.p.m. x 5 min y  
mantenido a 4 ºC o ­20 ºC hasta su utilización en el  
ELISA. Las muestras de suero fueron conservadas a  
2
016, Givens y Newcomer 2017, Walz et al., 2017).  
Además, cuatro vacas no se vacunaron con el propósito  
de usarlas como centinelas para realizar vigilancia  
activa de la infección en el hato y agotamiento de los  
anticuerpos contra el VDVB durante el ensayo (Cuadro  
­75 °C.  
1
).  
Diseño experimental  
Cuadro 1. Características de las unidades experimentales.  
Estatus serológico 0 días Preñez  
Estatus serológico para VDVB  
Seroconversión  
(42 días)  
UE  
Edad 0 días  
Años/Lactancia) VLBE HVB­1  
0 días  
Estatus  
(0 días)  
­
+
+
+
­
Vacunación  
(
(Días)  
161  
0
(Dosis)  
1
4/2  
7/5  
7/5  
11/8  
5/3  
8/5  
7/4  
7/6  
8/5  
8/6  
5/3  
5/3  
6/4  
6/4  
7/5  
7/6  
7/6  
7/6  
7/6  
4/2  
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
0
0
0
0
1
1
1
­
2
3
4
5
6
7
8
9
+
+
+
+
+
­
0
100  
0
173  
0
0
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
1
1
+
+
+
+
+
+
+
+
+
+
+
+
+
0
0
0
0
0
0
0
0
1
1
1
1
1
1
1
1
1
1
0
1
2
2
2
2
2
2
2
2
2
2
2
2
3
4
5
6
7
8
9
0
0
0
2
0
203  
(
UE) = Unidad Experimental, (+) = Positivo, (­) = Negativo.  
ISSN 1022­1301. Archivos Latinoamericanos de Producción Animal. 2020. 28 (1­2): 41­51  
42  
Seroconversión al VDVB en vacas coinfectadas con VLBE y HVB­1  
Valoración de la seroconversión al VDVB  
Caracterización molecular de la infección  
persistente causada por el VDVB  
El cambio del estatus sanitario de las vacas  
seronegativas para el VDVB y vacunadas contra el  
VDVB a seropositivas fue determinado mediante la  
prueba ELISA (ID Screen® BVD p80 Antibody  
Competition), lo que indicó seroconversión. La prueba  
ID Screen® BVD p80 Antibody Competition fue válida  
si la media de la densidad óptica (DO) del control  
negativo fue superior a 0.7 (DOCN > 0.7) y si la media  
de la DO del control positivo fue inferior al 30 % de la  
DO del control negativo (DO /DO < 0.30). Además,  
Extracción  
de  
ARN  
y
reacción  
de  
retrotranscripción: la extracción de ARN viral se  
realizó a partir de 250 µL de suero sin anticoagulante  
empleando Trizol (Ambion, USA) con base en las  
instrucciones del fabricante. El ARN extraído fue  
utilizado de forma inmediata para sintetizar ADN  
complementario empleando RevertAid H Minus First  
Strand cDNA Synthesis Kit (Fermentas, Lituania)  
según instrucciones del fabricante. El ARN y el ADN  
complementario obtenidos fueron conservados a ­75 °C  
hasta su uso en la reacción en cadena de la polimerasa  
CP  
CN  
una muestra se consideró positiva si el porcentaje de  
competencia (S/N %) fue inferior o igual al 40 % (S/N  
%
≤ 40 %), dudoso si el 40 % < S/N % ≤ 50 % y  
(
PCR). La reacción de retrotranscripción se llevó a cabo  
en el termociclador 2 720 (Applied Biosystems, USA).  
negativo si el S/N % > 50 %. Como resultado, el punto  
de corte fue S/N % :40­50. La lectura de la placa de  
ELISA se realizó  
espectrofotómetro  
ASCENT, Thermo, USA) mediante el programa IDSoft  
v3.10 (ID.vet, Grabels, France). El incremento en la  
a
450 nm empleando un  
PCR para detectar el VDVB: la caracterización  
molecular del VDVB se realizó empleando el dos pares  
de cebadores, 324(+)/326(­) y BP189­389(+)/DVB(­),  
especializado (MULTISKAN  
dirigidos  
a
la región 5'­UTR  
y
5'­UTR­Erns,  
concentración  
de  
anticuerpos  
anti­p80  
fue  
respectivamente. El cebador 324 corresponde a los  
nucleótidos 108­128 del VDVB y tiene la secuencia 5'­  
determinado mediante el porcentaje de inhibición, que  
es la medición inversa al porcentaje de competencia y  
fue estimado por medio de la fórmula propuesta por  
Machado et al. (2015). En consecuencia, los animales  
que incrementaron los niveles de anticuerpos,  
mostraron porcentajes de inhibición superiores al 50  
ATGCCCWTAGTAGGACTAGCA­3', el  
cebador 326 corresponde a los nucleótidos 395­375 del  
VDVB tiene la secuencia 5'­  
TCAACTCCATGTGCCATGTAC­3' (Monteiro et al.,  
019). Por su parte, el cebador BP189­389 corresponde  
mientras,  
y
2
%
.
a los nucleótidos 190­207 del VDVB y tiene la  
secuencia 5'­AGTCGTCARTGGTTCGAC­3' (Monteiro  
et al., 2019), mientras, el cebador DVB­R corresponde  
a los nucleótidos 1367­1348 del VDVB y tiene la  
secuencia 5'­TTYTCRCTNGCRTCCATCAT­3' (UNDIVE  
PI (%) = [(DOCN  DOMuestra O CP) / DO ] x 100  
CN  
Se realizaron tres intervenciones. La primera fue la  
evaluación base (E0), que permitió constatar el estatus  
asociado con la presencia del VLBE, HVB­1 y del  
estatus serológico relacionado con el VDVB de cada  
vaca a los cero días de iniciado el ensayo, así como,  
aplicar la primera dosis de vacuna; la segunda  
evaluación (E1) fue realizada a los 21 días post­  
vacunación para valorar la seroconversión, el estado  
nutricional del hato y aplicar la segunda dosis de la  
vacuna en las vacas asignadas al programa de  
vacunación con dos dosis. Finalmente, se efectuó la  
tercera evaluación (E2) a los 42 días post­vacunación  
para determinar la seroconversión contra el VDVB y  
estado general de la nutrición en el hato al final del  
ensayo.  
2
020). El volumen final de cada reacción de PCR  
empleando los cebadores 324(+)/326(­) fue de 20 µL y  
consistió en 10 µL de Phusion U Multiplex PCR Master  
Mix #F­562S (Invitrogen, USA); 1.2 μL (0.3 μ M/μL)  
de cada uno de los cebadores, 5.6 μL de H2O libre de  
ARNasas (Invitrogen, USA)  
y
2
µL de ADN  
complementario. Las condiciones de la reacción fueron  
las siguientes: desnaturalización inicial a 98 °C x 2  
min, 40 ciclos de desnaturalización a 98 °C x 20 s,  
anillamiento a 58 °C x 30 s y extensión a 72 °C x 15 s,  
seguido de una extensión final a 72 °C x 5 min  
(
UNDIVE 2020). El producto esperado fue de 288 pb.  
Posteriormente, se realizó el PCR para amplificar la  
región parcial de la poliproteína del VDVB desde 5'­  
UTR a la región Erns usando los cebadores BP189­  
Detección del VLBE y HVB­1 por serología  
3
89(+)/DVB(­). El volumen final de cada reacción de  
La seroprevalencia del VLBE y HVB­1 fueron  
valoradas utilizando ID Screen® BLV Competition  
(
PCR fue de 20 µ L y consistió en 10 µ L de Phusion U  
Multiplex PCR Master Mix #F­562S (Invitrogen, USA);  
2
de H2O libre de ARNasas (Invitrogen, USA) y 2 µ L de  
ADN complementario. Las condiciones de la reacción  
ID.vet, Grabels, France) y ID Screen® IBR gB  
μ L (0.5 μ M/μ L) de cada uno de los cebadores, 4 μ L  
Competition  
(ID.vet,  
Grabels,  
France),  
respectivamente. El procedimiento de cada ELISA fue  
efectuado con base en las instrucciones del fabricante.  
ISSN 1022­1301. Archivos Latinoamericanos de Producción Animal. 2020. 28 (1­2): 42­51  
4
3
Pichardo­Matamoros et al.  
fueron las siguientes: desnaturalización inicial a 98°C x  
min, 40 ciclos de desnaturalización a 98 °C x 20 s,  
anillamiento a 60 °C x 30 s y extensión a 72 °C x 1 min,  
seguido de una extensión final a 72 °C x 10 min  
secuencias correspondientes a la muestra de ADN  
positiva en ambas PCR fueron concatenadas y se cargó  
al GenBank una secuencia única de 1194 nucleótidos  
(cepa ABART­2 asignada dentro del genotipo del  
VDVB­1a, número de acceso: MT024564).  
2
(
UNDIVE 2020). El producto esperado fue de 1178 pb.  
Electroforesis: los productos amplificados por PCR  
Calidad nutricional  
fueron separados en gel de agarosa al 2 % y teñidos con  
GelRed Nucleic Acid Stain 10000X in Water (Biotium,  
USA). Se emplearon 2 μL de buffer de muestra 6X  
DNA Loading Dye #R0611 (Fermentas, Lituania) y 1 μL  
En un subgrupo de vacas, tomadas al azar, se evaluó  
de manera general la eficiencia del plan nutricional  
cuantificando beta­hidroxibutirato (BHBA) y glucosa  
en sangre mediante FreeStyle Optium Neo Strip β­  
ketone and Glucose Monitoring System (Abbott  
Diabetes Care Ltd., UK) con base en lo planteado en la  
literatura para la valoración a nivel de hato (Oetzel  
2015). Se consideró un caso de cetosis subclínica  
cuando se determinó un nivel de 1.2 mmol/L a 3.0  
mmol/L de BHBA según Iwersen et al., (2013), Oetzel  
(2015) y Brunner et al., (2019), así como, un  
desequilibrio en el metabolismo de la glucosa cuando  
sus valores en sangre no fueron normales (40 mg/dL  
de glucosa ≤ normoglicemia ≤ 60 mg/dL de glucosa)  
conforme lo descrito por Mair et al., (2016).  
(
#
0.5 μg / gL) de GeneRulerTM 100bp DNA Ladder Plus  
SM0321 (Fermentas, Lituania). La separación de los  
amplicones se realizó empleando el equipo de  
electroforesis Fotodyne Model N°1­1430 a 80 v x 40  
min, una vez separados se visualizaron en el  
capturador de imágenes e iluminador ultravioleta  
(
UVP BioDoc­1tTM Imaging System/FirstLight UV  
illuminator, USA).  
Secuenciación y análisis de secuencias: el  
amplicón de ADN de cada PCR positiva fue purificado  
con ExoSAP­IT™ PCR Product Cleanup Reagent  
(
Applied Biosystems, USA) según instrucciones del  
fabricante y luego fue almacenado a ­75 °C hasta su  
envío a Macrogen (Macrogen Co., Ltd., Corea del Sur)  
para ser secuenciado según el método de Sanger.  
Posteriormente, las secuencias de referencia [cepas  
NADL (número de acceso al GenBank: AJ133739) y  
Singer (número de acceso al GenBank: MH133206)]  
dentro del genotipo VDVB­1a fueron encontradas  
mediante la herramienta de búsqueda para la  
alineación básica local de nucleótidos (BLASTn) (NCBI  
Análisis estadístico  
El análisis estadístico fue realizado utilizando el  
programa InfoStat v2018I (Di Rienzo et al., 2011) y la  
significancia del análisis fue establecida con un valor  
de p ≤ 0.05. La asociación entre el programa de  
vacunación estándar  
y de una dosis sobre la  
seroconversión contra el VDVB fue evaluada en los  
grupos usando la prueba exacta de Fisher  
bidireccional. También, se generaron gráficos de  
densidad de puntos para las concentraciones de cada  
variable cuantitativa.  
2
019). Luego, las secuencias obtenidas se analizaron y  
editaron con el programa MEGA (Molecular  
Evolutionary Genetics Analysis, v6) y se alinearon  
usando ClustalW 1.6 (Tamura et al., 2013). Las  
Resultados  
Presencia del virus de la leucosis bovina  
enzoótica (VLBE), virus de la diarrea viral  
bovina (VDVB) y herpesvirus bovino 1 (HVB­1)  
Seroconversión  
calostrogénesis  
contra  
el  
VDVB  
y
La evaluación de una vaca no vacunada­seronegativa al  
VDVB, desde el inicio hasta el final del ensayo, sugiere  
que durante el estudio no hubo infección activa en el  
hato; asimismo, tres vacas no vacunadas­seropositivas  
desde el inicio del experimento mantuvieron su estatus  
a los 42 días sin mostrar incremento significativo en el  
porcentaje de inhibición, lo que refuerza la noción de la  
ausencia de infección causada por el VDVB durante la  
investigación. Además, las vacas vacunadas mostraron  
un porcentaje de inhibición que osciló entre 83 y 93 %,  
lo que indicó que el 93.75 % (15/16) de las vacas  
vacunadas­seronegativas seroconvirtieron contra el  
VDVB (Cuadros 2 y 3).  
De un total de 82 sueros evaluados mediante pruebas  
de inmunoabsorción ligada a enzimas, se determinó la  
presencia del VLBE en 95.1 % (78/82) de las muestras.  
Luego, se estimó en un subgrupo de muestras un 29.3  
%
(17/58) seropositivas para el VDVB y un 95.7 %  
(
45/47) seropositivas para HVB­1.  
ISSN 1022­1301. Archivos Latinoamericanos de Producción Animal. 2020. 28 (1­2): 43­51  
44  
Seroconversión al VDVB en vacas coinfectadas con VLBE y HVB­1  
Cuadro 2. Seroconversión en animales vacunados contra el VDVB.  
Porcentaje de inhibición ( %)  
Porcentaje de inhibición ( %)  
UE PV  
0 días 21 días 42 días  
UE PV  
0
días 21 días 42 días  
1
0
0
0
0
1
1
1
1
1
11  
95  
90  
87  
13  
16  
20  
12  
7
10  
93  
90  
91  
NA  
NA  
NA  
NA  
NA  
49  
11  
94  
91  
89  
87  
84  
11  
88  
85  
87  
11  
12  
13  
14  
15  
16  
17  
18  
19  
20  
2
2
2
2
2
2
2
2
2
2
5
27  
8
13  
24  
12  
6
4
16  
4
71  
81  
92  
90  
91  
83  
91  
88  
80  
87  
88  
2
3
4
5
6
7
8
9
0
72  
79  
78  
69  
72  
70  
63  
75  
68  
1
2
5
(
UE) = Unidad Experimental, (PV) = Programa de vacunación, (NA) = No analizado.  
Cuadro  
3.  
Contingencia  
para  
estudiar  
la  
Enfermedades metabólicas  
independencia entre el programa de vacunación y la  
seroconversión contra VDVB.  
La nutrición y los problemas metabólicos afectan la  
respuesta inmune. El análisis individual de los casos  
permitió identificar cuatro vacas con cetosis subclínica  
y una con hipoglucemia en la evaluación base (0 días)  
y otra vaca con hipoglucemia al final del ensayo (42  
días). La valoración a nivel de hato indicó que al inicio  
Programa de vacunación Seroconversión Total  
Sí  
4
No  
1
1
5
2
11  
15  
0
1
11  
16  
Total  
del estudio el 40 (4/10) de las vacas  
experimentaban cetosis subclínica, lo que superó el 10  
de los casos como valor umbral para intervenir el  
%
Para un valor del estadístico Irwin­Fisher bilateral de 0,20 se genera  
un valor de p = 0.3125, lo que indica que las variables son  
independientes. Para una significancia estadística de α ≤ 0.05, se  
concluye que la diferencia observada no refleja una verdadera  
diferencia entre los grupos. 1, Aplicación de una dosis de vacuna  
contra VDVB; 2, Aplicación de dos dosis de vacuna contra VDVB.  
%
plan nutricional. Sin embargo, las valoraciones  
siguientes (a los 21 y 42 días) no superaron el umbral y  
los casos de cetosis subclínica e hipoglucemia fueron  
estados transitorios y en animales diferentes (Cuadro  
4
).  
Cuadro 4. Concentración de beta­hidroxibutirato (BHBA) y glucosa en sangre.  
Caso  
Evaluaciones de BHBA (mmol/L)  
Evaluaciones de glucosa (mg/dL)  
0
días  
1.7  
0.9  
1.2  
21 días  
0.7  
0.9  
0.6  
0.7  
42 días  
0.4  
0.6  
0.8  
0.5  
0 días  
45  
52  
52  
43  
21 días  
56  
44  
46  
49  
42 días  
45  
1
2
3
4
5
6
7
8
9
0
40  
43  
42  
1.2  
0.8  
0.6  
0.6  
1,3  
0.7  
0.6  
NA  
0.9  
0.6  
0.8  
0.3  
NA  
NA  
NA  
0.6  
0.9  
0.5  
0.9  
0.8  
0.4  
NA  
48  
38  
47  
50  
43  
48  
45  
49  
49  
NA  
NA  
NA  
44  
48  
42  
49  
48  
37  
47  
1
48  
NA  
1
1
(
NA)= No analizado.  
En general, las concentraciones de beta­  
hidroxibutirato sanguíneo (BHBA) glucosa se  
ubicaron dentro del rango normal para la especie  
(Figura 1).  
y
ISSN 1022­1301. Archivos Latinoamericanos de Producción Animal. 2020. 28 (1­2): 44­51  
4
5
Pichardo­Matamoros et al.  
Figura 1. Evaluación del estado nutricional de las vacas a nivel de hato durante la vacunación contra VDVB. (A) Concentración de beta­  
hidroxibutirato en sangre, las líneas horizontales representan el rango en el cual se presentó cetosis subclínica (1.2 mmol/L de BHBA ≤ cetosis  
subclínica ≤ 3.0 mmol/L de BHBA). (B) concentración de glucosa en sangre, las líneas horizontales indican un estatus normoglucémico (40  
mgl/dL de glucosa ≤ normoglucemia ≤ 60 mg/dL de glucosa). Los niveles de BHBA y glucosa fueron determinados antes de la vacunación  
(
evaluación base a los 0 días), a los 21 días después de haber aplicado la primera dosis de vacuna o durante la revacunación y a los 42 días  
después de haber iniciado el programa de vacunación.  
Discusión  
Seroconversión contra el VDVB en animales  
vacunados y naturalmente coinfectados con  
VLBE y HVB­1  
similar, Jaworski et al., (2018) reportaron que el VLBE  
no afecta los niveles de anticuerpos obtenidos cuando  
se vacuna contra el virus de la fiebre aftosa y Frie et al.,  
(
2016) describieron que las vacas infectadas con VLBE  
Las vacas coinfectadas respondieron de forma  
generan anticuerpos contra el VDVB de forma  
semejante a las vacas seronegativas vacunadas con  
virus vivo modificado.  
excelente  
a
la inmunización contra el VDVB,  
independientemente si se empleó un programa de  
vacunación de una o dos dosis, lo cual indica que el  
efecto de la coinfección con VLBE y HVB­1 no impide  
la seroconversión y permite inferir que el efecto  
En ese mismo sentido, si el efecto inmunosupresor  
del VLBE y HVB­1 no es suficiente para impedir el  
desarrollo de una respuesta inmune eficaz contra el  
VDVB, las diferencias encontradas en distintas  
investigaciones sobre el efecto inmunosupresor del  
VLBE (Farias et al., 2016; Frie et al., 2016, 2017, 2018;  
Jaworski et al., 2018) podrían explicarse por el  
sinergismo con otros factores aún no conocidos o  
parcialmente descritos que pueden aumentar el efecto  
inmunosupresor de estos virus es parcial  
e
independiente. Además, no hubo aborto en vacas  
preñadas vacunadas­seronegativas incluidas en el  
estudio.  
Dado que, se ha informado que en animales  
seropositivos al VLBE la evolución de la respuesta  
inmune es anormal debido a alteraciones en la  
inmunosupresor.  
Por  
ejemplo,  
el  
virus  
de  
producción  
y
actividad de elementos humorales  
inmunodeficiencia bovina, un Lentivirus dentro de la  
familia Retroviridae también causa infección  
persistente e inmunosupresión (Zhang et al., 1997,  
Rodrigues et al., 2019) y puede generar coinfección  
junto con VLBE, HVB­1 o VDVB (Rola et al., 2005).  
importantes para desarrollar una respuesta inmune  
humoral eficiente (Frie y Coussens 2015, Farias et al.,  
2
016, Frie et al., 2017), el efecto sobre el sistema  
inmune podría incrementarse por el sinergismo con  
HVB­1 (Bilge­Dagalp et al., 2008, Jones 2019). No  
obstante, el resultado obtenido en este estudio sugiere  
que el efecto de la coinfección con estos virus, en caso  
de existir sinergismo, no es tan fuerte como para  
inhibir la seroconversión contra el VDVB en los  
animales vacunados con virus vivo atenuado. De forma  
O bien, porque el mecanismo inmunomodulador de  
cada virus para permanecer en el hospedador no afecta  
la producción de anticuerpos contra el VDVB y otros  
virus debido a que la subpoblación de células B  
productora de anticuerpos no se altera (Frie et al.,  
ISSN 1022­1301. Archivos Latinoamericanos de Producción Animal. 2020. 28 (1­2): 45­51  
46  
Seroconversión al VDVB en vacas coinfectadas con VLBE y HVB­1  
2
016) o porque la reactivación espontánea del VLBE  
inmunosupresión y modifican la calidad del calostro.  
Este estudio permite sugerir que las vacas coinfectadas,  
tiene mecanismos diferentes que pueden o no coincidir  
durante su desarrollo con el efecto inmunosupresor de  
HVB­1 (Jaworski et al., 2019).  
aunque normoglucémicas (Mair et al., 2016)  
y
expuestas a un plan nutricional con alto riesgo para  
sufrir cetosis subclínica (Iwersen et al., 2013, Oetzel,  
2015), tienen la capacidad para seroconvertir contra el  
VDVB cuando son vacunadas.  
Vacunación contra el VDVB y calostrogénesis  
en hatos coinfectados con VLBE y HVB­1  
La obtención de calostro de buena calidad requiere  
un programa de vacunación muy eficiente. Dado que,  
las vacunas comerciales no proveen una protección del  
En este ensayo, una vaca no seroconvirtió cuando se  
aplicó una dosis de la vacuna (Cuadro 2). Dado que, no  
se determinó dependencia para la seroconversión  
contra el VDVB con respecto al programa de  
vacunación y es engañoso considerar que el efecto  
inmunosupresor de los virus explique el evento, el  
análisis adicional mediante la PCR y secuenciación,  
permitió establecer una infección persistente con el  
VDVB­1a (Figura 2, cepa ABART­2). Esta condición  
genera anergia clonal en el animal infectado (Gómez­  
Lucía et al., 2006) y unida al principio del ELISA ID  
Screen® BVD p80 Antibody Competition utilizada en  
este estudio, no es posible distinguir entre las cepas  
contenidas en la vacuna asociadas con el VDVB­1a y  
VDVB­2a (Factor et al., 2016, Irianingsih et al., 2019).  
Por lo que, la falta de respuesta del sistema inmune  
contra el VDVB­1a en la vaca con infección persistente  
y este resultado indican que la anergia clonal para la  
p80 del virus se extiende también al VDVB­2a.  
1
00 % y las enfermedades se presentan en el hato de  
forma dinámica, resulta poco probable vacunar solo  
animales sanos y sin problemas metabólicos, por lo  
que, los fracasos esperados durante un programa de  
vacunación pueden ser mayores. De forma particular,  
este ensayo incluyó enfermedades endémicas  
inmunosupresoras  
que  
pueden  
afectar  
la  
seroconversión contra el antígeno contenido en la  
vacuna, pero la seroconversión obtenida fue de 93.75 %  
(
15/16), valor ideal según las instrucciones del  
fabricante para la vacuna EXPRESS® FP 10­HS  
utilizada en este ensayo (Boehringer Ingelheim, 2019).  
También, es erróneo tratar de establecer el efecto de  
uno de estos virus sobre la respuesta inmune sin  
considerar la influencia de alteraciones nutricionales o  
la presencia de otros agentes infecciosos que causan  
Figura 2. Comparación de la secuencia parcial de nucleótidos de la región 5'­UTR y poliproteína de la cepa ABART­2 (1194 nucleótidos de  
longitud, color azul) con cepas representativas del VDVB. Cepa NADL (VDVB­1a no citopático, desde 190nt­1383nt) y cepa Singer (VDVB­1a  
citopático, desde 191nt­1384nt). Los puntos indican la similitud con la cepa NADL y los nucleótidos en color rojo las regiones polimórficas. La  
cepa ABART­2 mostró 100 % de similitud con la cepa Singer y 96 % de similitud con la cepa NADL.  
­51